Privacy‑First Bioinformatics Studio Laboratory Grade.
Edit sequences, simulate protein folding, and visualize genomic data directly in your browser. Zero cloud uploads. Your research never leaves your device.
Client‑side Bioinformatics
Edit, visualize, and simulate DNA, entirely in your browser
Browser‑native & Local‑first
Nuxron runs entirely on the client — sequences are persisted in IndexedDB, computations happen in the browser, and no user data is uploaded to any server by default.
Web‑Worker Simulations
Heavy operations (GC content, reverse complement, translation) run in a Web Worker so the UI stays responsive even for long sequences.
Client‑side Biosecurity
A local biosecurity screen scans sequences against a hashed blocklist in the browser, showing warnings without sending sensitive data to external services.
Editor, Export & Integrations
Monaco-powered editor with FASTA support, 2D/3D visualizations, and local export (FASTA, PDF). Lightweight APIs let you script analyses while keeping data local.
>Example_Gene
ATGCGTACGTAGCTAGCTAGCTAGCTA
// translate.worker.ts (simplified)
export function translateDNA(dna: string): string {
const table: Record<string,string> = {
'ATG':'M','GCT':'A','GCC':'A','GCA':'A','GCG':'A',
'TGA':'*','TAA':'*','TAG':'*'
// ...full codon table omitted for brevity
};
let protein = '';
const seq = dna.replace(/[^ATGCN]/gi, '').toUpperCase();
for (let i = 0; i + 2 < seq.length; i += 3) {
protein += table[seq.slice(i, i + 3)] ?? '-';
}
return protein;
}- Sequences Analyzed
- 124,582
- Local Simulations / min
- 3,450
- Average UI Response
- 85 ms
- FASTA & PDF Exports
- 4,120
- Supported File Types
- FASTA · GenBank · Plain Text
- Open‑Source Contributors
- 12
“Nuxron transformed our lab onboarding — students can explore sequence translation and 3D visualizations without any server setup. The client‑side biosecurity screening and local storage gave our team the confidence to use Nuxron in sensitive projects while keeping all data on-device.”
Explore DNA, privately, instantly, in your browser
Nuxron is a local‑first bioinformatics studio, edit FASTA, visualize a 3D helix, run GC and translation simulations in a Web Worker, and export results (FASTA/PDF), all without uploading your data.